Seasonal activity of CITRUS aphids was monitored by direct sampling and yellow water–pan traps during 2003 and 2004, in CITRUS groves in Sari area of Mazandaran. CITRUS TRISTEZA VIRUS transmission ability of the predominant aphid species was also studied. The proportions of the different aphid species from direct sampling were: Aphis gossypii (78%), Toxoptera aurantii (8%), Macrosiphum euphorbiae (8%) and Aulacarthum solani (6%) in 2003, and A. gossypii (51%), Aphis spiraecola (21%), T. aurantii (12%), Aphis fabae (9%), Aphis craccivora (3.5%), Aphis nasturtii (2%), Myzus persicae (0.5%), M. euphorbiae (0.5%) and Aphis rumicis (0.5%) in 2004. The results provided additional evidence for A.gossypii as the most common aphid species in CITRUS groves in this area. Transmission tests were conducted using Mexican lime seedlings as donor and receptor plants for the VIRUS, 20 and 10 aphids of the four aphid species (A. gossypii, T. aurantii, A. spiraecola and A. fabae) were used per to infest receptor plant. Rates of the infected plants by the 20 and 10 individuals of A. gossypii were equal to 3.33 and 1.66 percents respectively and probability of the individual aphid transmission was calculated 0.17% in the two cases.The other aphid species were not able to transmit the CTV in the East of Mazandaran. The yellow water-pan trap method had not adequate efficiency in comparison to the direct sampling of aphids. A. rumicis, A. nasturtii and A. solani were the first record of aphids fauna on CITRUS in the North of Iran.

Background and Objectives: TRISTEZA is one of the most important viral diseases in CITRUS products worldwide. Fars province is one the most important CITRUS growing regions in Iran. Infection to CITRUS TRISTEZA VIRUS (CTV) has been reported from many CITRUS orchards in this region. The objectives of this research were to determine CTV distribution, evaluation of CITRUS species infection to CTV and to compare the infection prevalence rate to CTV in different regions of Fars province.Material and methods: This cross sectional study was performed on 230 samples collected from different CITRUS species grown in Kazeroun, Firouzabad, Ghir-o-Karzin, Jahrom, Darab and Fasa regions. First existence of infection to TRISTEZA VIRUS was detected using ELISA. The prevalence of infection was calculated based on the rate of infection in the total numbers of samples. Next, a PCR amplification was performed based on the primers specific for coat protein and p23 genes.Results: Based on the ELISA test, all CITRUS species were infected to CTV. The VIRUS infection was detected in all the regions of interest. Totally, 24.35% out of 230 collected samples were infected to CTV. The highest infection prevalence was found in Jahrom, Ghir-o-Karzin, D arab , Kazeroun, Firouzabad and Fasa, respectively. Furthermore, mandarin was found the most infected fruit between all CITRUS family, followed by lemon Lesbon, lime, orange and sweet lime, respectively.Conclusion: The results of this research showed that CTV infection has increased during the past years. As a result, control ofthe disease in this region is necessary.

TRISTEZA caused by CITRUS TRISTEZA VIRUS (CTV), is the most important viral disease of CITRUS worldwide. Serious damages of the disease have been reported from many CITRUS growing areas of the world. CTV particles are restricted to phloem and are transmitted by aphids in a semipersistent manner. CTV was introduced from Japan to Mahdasht orchards in Mazadaran province in 1969. Its natural spread with the vector Aphis gossipii was shown in the infected areas (Rahimian et al., 2000). Following the transport of VIRUS-infected scions or plants from the east of Mazandaran (infected area) to the western part of the province (Tarvijiet al., 2012), the risk of transmission was considered by a similar way in the nurseries of Guilan province. Preliminary survey of the disease was carried out in November 2012. Five of 20 Unshiu (CITRUS unshiu) and Thomson navel (C.sinencis) plants on Citrange rootstock were found infected by serological direct tissue blot immunoassay using a commercial antiserum (Bioreba, Switzerland). Infection of the plants was confirmed by a two-step RT-PCR with T36cp+/T36cp- primers after nucleic acid extraction with Rneasy Plant Mini Kit (Qiagen). RT and PCR was carried out respectively according to manufacture protocols of Revert Aid and PCR Master Mix (Fermentas).

CITRUS TRISTEZA VIRUS (CTV) is among the most destructive pathogens of CITRUS and causes substantial economic losses to CITRUS industry worldwide. Considering recent distribution of this pathogen and its capability of transmission by existing aphid vectors in Iran, detection of this VIRUS should be mandatory for controlling the damage caused by this pathogen in Iran, as one of the major CITRUS producing countries. Toward this aim, developing a reliable and sensitive detection method such as enzyme- linked immunosorbant assay (ELISA) would be the first step to detect CTV in large scale screenings of field samples. As the serological method requires great amounts of specific antibody, consequently preparation of a large scale antigen source for immunization process would be necessary. In this study the coat protein gene of CTV (CP25) was amplified by polymerase chain reaction from a cloned CP25 gene in pTZ57R/T and subcloned in pET26b expression vector and named pET-CP25. Two Escherichia coli strains of BL21 and Rosetta Gami (DE3) were transformed by pET-CP25. Expression of recombinant protein was induced by IPTG. The authenticity of recombinant protein was confirmed by western immunoblot analysis using a polyclonal antiserum against CTV particles. The results indicated that CTV coat protein gene was expressed in E. coli. This recombinant protein could be used as a source of antigen for immunization process.

Introduction: CITRUS TRISTEZA VIRUS (CTV), the causal agent of the most important viral disease of CITRUS, is transmitted by infected reproductive materials and several aphid species. TRISTEZA has been reported from the north and south of Iran and Aphis gossypii has been known as the vector of TRISTEZA. Detection of the VIRUS in the vectors has been before carried out based on biology, serology and electron microscopy. Access to rapid and sensitive molecular techniques for epidemiological studies is the aim of the study. Reverse transcription polymerase chain (RT-PCR) and RT-nested PCR techniques were applied in the present study. Materials and Methods: The SD4-infected Mexican lime (CITRUS aurantifolia) seedlings acquired from the VIRUS collection with origin of declining trees of Sari region were used as donor host for VIRUS transmission assays. Pure colony of A. gossypii after rearing on cucumber (Cucumis sativus) was placed on the infected seedlings. 20 seedlings were considered for biological indexing. 20 aphids were placed carefully on healthy Mexican lime seedlings by brush. The acquisition and transmission feeding time of VIRUS were 48 hours and 20 aphids were considered for each test plant. The seedlings were transferred to the conditioned greenhouse (23/16° C, day/night). Indirect VIRUS detection was carried out by monitoring of symptoms, direct tissue blot immuonoassay with Biorba antiserum and two step RT-PCR with RNA extracted from indicator plants using SDS-Potassium acetate method and T36CPF/T36CPR primers. In direct detection VIRUS of aphid, RNA extracted by Trizol method and one step RT-PCR reaction using AMV Reverse Transcriptase enzyme by T36CPF/T36CPR primers were used. The final product of this reaction was introduced in the nested-PCR using T36CPF/P25R primers. RT-nested-PCR assay was applied also with PexF/PexR primers in the first stage and PinF/PinR in the second stage. Results and Discussion: Indirect VIRUS detection in melon aphid was carried out by survey of vein clearing and vein corking symptoms in the receptor indicator plants. A total of 4 of 20 Mexican lime seedlings showed the symptoms during 3 months after aphid transmission assay. The presence of VIRUS in these seedlings was confirmed by direct tissue blot immunoassay and RT-PCR techniques. Also a product of about 672 bp was amplified using specific primers of coat protein gene. Direct VIRUS detection with one-step RT-PCR and RNA extracted from aphids by Trizol method using T36CPF/T36CPR primers resulted 672 bp weak bands. By performing the second stage of PCR using T36CPF/P25R primers, 362 bp specific bands were obtained. On the other hand, RT-nested PCR with PinF/PinR and PexF/PexR primers was not able to detect the VIRUS in the infected aphids due to false positive reactions. The purpose of this study was to evaluate the effectiveness of different methods in selecting an appropriate method for detection of VIRUS in melon aphid, the most effective vector of CTV in Iran. The detection of VIRUS-associated targets in vectors that are capable of transmitting VIRUSes is crucial for both the studies of viral replication and the optimization of control strategies. Biological indexing is the earliest test of detection of VIRUS in aphids, which has the advantages and disadvantages, including the objective measurement of biological activities such as ability to transmit and reproduce based on production of symptoms, the long time required, and the specific greenhouse conditions. Although RT-PCR method has been used to detect a number of plant VIRUSes in vectors, the detection of VIRUS by this method is possible if extraction efficiency of RNA is increased by use of materials such as Gene Releaser and Trizol. Nevertheless, more sensitive methods are required for detection of semi-persistently and non-persistenly transmitted VIRUSes. Detection of CTV by nested RT-PCR was directly related to appropriate primers and efficient extraction procedure. Conclusion: According to this study, RNA extraction using Trizol method is the most appropriate method for extracting nucleic acid from aphids, so it has been shown that detection of CTV by nested RT-PCR technique was directly related to the used extraction procedure. In this research, detection of CITRUS TRISTEZA VIRUS in melon aphid for the first time in Iran was performed using RT-PCR and RT-nested-PCR molecular methods. The results showed that RT-nested-PCR based on the efficient extraction method and the selection of appropriate primers is a reliable technical for detection TRISTEZA VIRUS in its aphid vector, A. gossypii.

Despite the widespread occurrence of CITRUS TRISTEZA VIRUS (CTV) in some regions of southern and northern Iran, there is no information about the distribution and genetic variation of CTV isolates in Kerman province. In this study the prevalence and the molecular variability of CTV isolates from four CITRUS growing regions of this province, including Bam, Jiroft, Orzuieh and Hossein Abad, were investigated. Total RNA from CTV infected bark and midrib of different CITRUS trees was extracted and used for amplification of CP and K17 region of the polymerase genes of the CTV genome, by RT-PCR. The results of ELISA showed that out of 203 random CITRUS samples collected from the four regions in Kerman province; about 50% were infected with CTV. The rate of CTV infection in samples of Jiroft, Bam, Hossein Abad and Orzuieh, was 60%, 56%, 50% and 45%, respectively. PCR results showed the presence of expected 672 and 409 bp fragments for CP in 9 samples and K17 region of polymerase genes in 9 samples of the CTV genome respectively in 9 samples of Kerman province isolates. The resulted PCR products were inserted into pTZ57R/T plasmid, cloned in E.coli strain DH5a, sequenced, and compared with the related sequences from the GenBank by BLAST search program. The results revealed that on the basis of CP and a part of the polymerase genes, CTV isolates of Kerman province have a higher homology with the California stem pitting (SY568) and Japanese seedling yellows (NUagA) isolates. However, six isolates of Kerman province (KBA, KG-9, KG-10, KG-11, KH-10, KS-7), showed distinct differences with other CTV isolates in four amino acids in CP gene and formed a separate branch in dendrogram. 

IntroductionCITRUS TRISTEZA VIRUS (CTV) is one of the most devastating CITRUS diseases in Iran. The CTV genome is a positive single-stranded RNA molecule with a size of 19.3 kb containing 12 open reading frames (ORFs). CTV encodes two different coat proteins, of which the small coat protein (CPm) covers only the 3' end of the genome. CTV infected trees show symptoms such as stunting, yellows, reduced vigor and death. In addition, CTV generates three typical disease syndromes, including quick decline, stem pitting and seedling yellows. In total, more than 259 thousand hectares of CITRUS are grown in the north and south of Iran. Considering the lack of the complete genome sequence of Iranian CTV isolates and the different climatic conditions in CITRUS cultivation in the north and south of Iran, the genome of CTV isolates from Iran was determined for the first time and their phylogenetic relationships with other CTV isolates were studied. Materials and MethodsIn spring and fall 2015, 30 samples from Mazandaran province in northern Iran and 25 samples from Fars province in southern Iran were collected from trees suspected of being infected with CTVs. Total RNA was extracted using the RNX-Plus kit according to the manufacturer's instructions. CTV was identified using the specific primer pair CPF (5¢AAAGAAGGCGACGATGTTGT3¢) and CPR (5¢AGCTCCGGTCCAAGAAATCTG3¢) designed based on the coat protein gene of CTV. Reverse transcription was performed using MMuLV reverse transcriptase (Pars Tuos, Iran) and PCR reaction was performed using Amplicon 2x PCR Master Mix (Amplicon, Denmark). Infected samples were grafted onto sour orange seedlings. sRNAs were extracted using a protocol developed by Carra et al. (2006), and sRNA libraries were prepared according to the CATS protocol (Turchinovich et al., 2014). One microgram of each library was sequenced on the Illumina HiSeq2500 platform from Macrogen, South Korea. The CTV strains were determined by virtual replication and digestion or alignment of the region between the small coat protein (Cpm) and coat protein (Cp) genes. The phylogenetic tree was constructed by the maximum likelihood method using the T92+I nucleotide substitution model with 500 bootstrap repeats by MEGA7. The nucleotide and amino acid similarity matrix was calculated using SDTv.1.2 software. Potential recombination events in the genome were determined using RDP v.5.5.  Results and DiscussionCTV infection was detected in 17 samples from Mazandaran province (56% of samples) and in 8 samples from Fars province (33% of samples) using a CPF/R-specific primer pair. CTV symptoms were mild to severe stunting, chlorosis, yellowing, vein yellowing, and severe decline in the CITRUS samples from the north of Iran, while CTV symptoms in the samples from the south of Iran were stunting, chlorosis, dieback and quick decline. Three months post inoculation, symptoms of severe stunting and chlorosis appeared in seedlings inoculated with isolates from the north, while mild stunting and yellowing appeared in seedlings of sour orange inoculated with CTV isolates from the south. By assembling the contigs obtained from the RNA-seq data, the complete genomes of IR-North1, IR-North2, IR-South1, and IR-South2 isolates were reconstructed with lengths of 19296, 19302, 19252, and 19251 nucleotides, respectively. The Iranian CTV isolates had nucleotide similarity in the range of 95.2-77.5% with other CTV isolates deposited in GenBank. The polymerase, P65, and coat protein genes of the Iranian CTV isolates showed identity at the amino acid level of 80.6-94.1%, 88-93.9%, and 92.4-96.4%, respectively, with other CTV isolates. Analysis of the CTV strains revealed that IR-North1 resembles the severe decline strain belonging to genotypic group T36, while IR-South2, IR-North2, and IR-South1 belong to the stem pitting and seedling yellows strains of genotypic group VT/T3 and are similar to strains T3, SY, and T318A, respectively. In the phylogenetic tree based on the full length of the CTV genome, three subclades were designated: VT, T68, and T36. IR-North2, IR-South1, and IR-South2 isolates were grouped into VT, and IR-North1 isolate was grouped into T36. Like the reference CTV isolate, the four Iranian CTV isolates had 12 open reading frames. Examination of the Replicase, RdRp, P65, P61, CPm, and CP proteins revealed 280 amino acid substitutions in 33 conserved motifs in Iranian CTV isolates. The isolate IR-North1 had only five substitutions; however, 97, 85, and 93 substitutions occurred in the isolates IR-North2, IR-South1, and IR-South2, respectively. Most substitutions were found in the replicase and p61 proteins, which are involved in VIRUS replication and assembly, respectively. RdRp and p23 proteins had the least amino acid substitutions. No known conserved motif was observed in P33, P6, P18, P13, and P20 proteins. In addition, IR-North1, IR-North2, and IR-South1 were recombinant. In IR-North1, 1426 nucleotides in the P65 gene and 773 and 2444 nucleotides in the replicase gene were recombinant in IR-North2 and IR-South1 isolates, respectively. ConclusionAn analysis of symptoms, nucleotide diversity, dominant strains, and the phylogenetic relationship of the four Iranian CTV isolates sequenced in this study revealed that two isolates from northern Iran were quick decline and seedling yellows strains, falling within the genotypic groups T36 and VT. These groups were distinguished by distinct symptoms and a separate phylogenetic position. Conversely, the two southern CTV isolates were closely associated with CTV stem pitting strains, classified into genotypic groups VT and T3, sharing a close phylogenetic position.

In this research, that was carried out for produce CTV free plants, factorial design based on complete randomized design with four treatments and four replications was used. Each treatment had 10 plantlets. Shoot-tip of infected Washington navel orange by TRISTEZA containing meristem and two leaf primordia was excised (0.2 - 0.4 mm). It was grafted on Troyer Citrange and Citrurnelo seedlings by two methods, inverted T-budding and in contact with the vascular ring. These seedlings had 3-5 cm length. Grafted seedlings were planted on liquid medium and incubated on growth chamber in 27°c and 16 hours photoperiod with 1000 lux illumination. If grafting was successful, plants were transplanted on suitable soil. Shoot-tip grafted plants were tested by DAS ELISA against TRISTEZA VIRUS.All of them were not infected. The results showed that inverted T- budding was more successful. There were no significant differences between used root stocks.

Background and Aims: Plant certification programs need reliable, fast, cheap and sensitive methods for detection of systemic pathogens with special interest in VIRUS and viroid detection. Reverse transcriptase-polymerase chain reaction (RT-PCR) has been documented as an alternative assay for certification of plant propagating materials. The main object of the present study was the optimization of a multiplex RT-PCR assay for simultaneous detection of CITRUS TRISTEZA VIRUS (CTV) and Hop stunt viroid (HSVd), the casual agents of CITRUS TRISTEZA and cachexia, together with the plant mRNA as an internal control for CITRUS certification in the country.Materials and Methods: Total RNA was extracted from healthy; CTV- and HSVd- infected CITRUS tissues and subjected to cDNA synthesis by M-MuLV H- reverse transcriptase, followed by optimization of simplex, diplex and multiplex RT-PCR (s-, d-, and mRT-PCR).Amplified fragments were further sequenced for evaluation of the accuracy of the assays.Results: CTV, HSVd and the plant internal control (Nad 5 gene) were successfully amplified in all assays and the sequence information revealed the accuracy of all assays in CITRUS certification programs.Conclusion: Results from the developed s-, d-, and mRT-PCR assays revealed these detection methods as excellent candidates for CITRUS certification.

TRISTEZA is one of the most important and devastating CITRUS viral disease in the world. Thermotherapy is one of the TRISTEZA management methods that used in this study. Thus 36 ‘Thomson Navel’ orange were placed in temperature controlled chamber (TCC) to investigate the effect of thermotherapy on elimination of TRISTEZA VIRUS. First, the scions were inoculated by grafting and after six months tested by ELISA. Plants were placed in 35/30oC (day/night) temperature for two weeks (as pre conditioning). Then they were incubated at: 40/30, 42/32, 44/34oC for 11 weeks, two weeks and 10 days, respectively. In the last temperature, 12 plants dried out and in six of the remaining plants, no infected plants were verified. The other 18 plants were alive but infected. Thermotherapy is considered as one of the healthy ways for CITRUS seedlings depends on plant species. VIRUSes infecting alone or together with shoot tip grafting (STG) led to the production of healthy seedlings. The results also indicate inefficiency of this method to eliminate VIRUSes and suggest using a combination of thermotherapy and STG.